http://rosalind.info/problems/revp/
Write a Python program called revp.py that will accept a FASTA-formatted file of a DNA sequence and will print the position and length of every reverse palindrome in the string having length between 4 and 12.
The program should print a "usage" statement for -h or --help flags:
$ ./revp.py -h
usage: revp.py [-h] FILE
Locating Restriction Sites
positional arguments:
FILE Input FASTA file
optional arguments:
-h, --help show this help message and exit
Here is an example input:
$ cat tests/inputs/1.fa
>Rosalind_24
TCAATGCATGCGGGTCTATATGCAT
The output given this input file:
$ ./revp.py tests/inputs/1.fa
5 4
7 4
17 4
18 4
21 4
4 6
6 6
20 6
A passing test suite looks like this:
$ make test
python3 -m pytest -xv --disable-pytest-warnings --flake8 --pylint
--pylint-rcfile=../pylintrc --mypy revp.py tests/revp_test.py
============================= test session starts ==============================
...
collecting ... collected 10 items
revp.py::FLAKE8 PASSED [ 9%]
revp.py::mypy PASSED [ 18%]
revp.py::test_revp PASSED [ 27%]
tests/revp_test.py::FLAKE8 SKIPPED [ 36%]
tests/revp_test.py::mypy PASSED [ 45%]
tests/revp_test.py::test_exists PASSED [ 54%]
tests/revp_test.py::test_usage PASSED [ 63%]
tests/revp_test.py::test_bad_file PASSED [ 72%]
tests/revp_test.py::test_ok1 PASSED [ 81%]
tests/revp_test.py::test_ok2 PASSED [ 90%]
::mypy PASSED [100%]
===================================== mypy =====================================
Success: no issues found in 2 source files
======================== 10 passed, 1 skipped in 1.29s =========================
Ken Youens-Clark [email protected]