Inspiration

After learning about nucleic acids and protein synthesis in biology class, we were inspired to think about how we can improve the integration of genetics into healthcare.

What it does

MutationSeeker identifies pathogenic mutations within a DNA base sequence of a gene, allowing geneticists to counsel patients about possible genetic risks to physiological diseases. Our prototype is programmed to recognize 2 pathogenic mutations found in the CAPN10 gene, whose variants are associated with type 2 diabetes. These 2 pathogenic mutations are: "TGATTTGCCCATCCCAGA" and "TAGAAGC". Any base sequence with either of a mutation in it will be recognized by the algorithm (ex. AATGATTTGCCCATCCCAGAAA, which contains the first mutation).

How we built it

The code is built in a way to identify mutations within the base sequence of a gene. To do this, it uses indexes in lists - indexes describe the position of items in a list. It recognizes when certain nucleotide bases are beside each other. By using this, the program is able to differentiate specific arrangements of the items in the list which can then be labelled as mutations associated with conditions.

Challenges we ran into

Seeing as we had no experience with programming prior to this project, we had to do research on which programming language would fit our purposes the best! We consequently chose Python to develop our system, spending hour after hour self-learning how to code Python from online tutorials.

Accomplishments that we're proud of

Seeing as this was our first programming project, we are proud that we were able to produce a functioning prototype for a concept with so much potential to improve healthcare!

What we learned

We learned the basics of how to code with Python.

What's next for MutationSeeker

Ideally, MutationSeeker would expand by integrating all the genetic information on databases such as the NCBI (National Center for Biotechnology Information) in order to be able to identify pathogenic mutations across all 23 pairs of chromosomes in humans. It would need to be updated as genetic research continues to identify new pathogenic mutations, reflecting the constant evolution of science.

References

https://www.ncbi.nlm.nih.gov/gene/11132

https://www.ncbi.nlm.nih.gov/nuccore/NC_000002.12?report=genbank&from=240586734&to=240599104

https://iubmb.onlinelibrary.wiley.com/doi/pdf/10.1080/15216540310001620977

https://www.cdc.gov/diabetes/library/features/hispanic-diabetes.html#:~:text=Diabetes%20Affects%20Hispanics%2FLatinos%20More,it%20at%20a%20younger%20age.

Built With

Share this project:

Updates