Skip to content

aomlomics/edna2obis

Repository files navigation

edna2obis Banner

Introduction

DNA derived data are increasingly being used to document taxon occurrences. To ensure these data are useful to the broadest possible community, GBIF published a guide entitled "Publishing DNA-derived data through biodiversity data platforms." This guide is supported by the DNA derived data extension for Darwin Core, which incorporates MIxS terms into the Darwin Core standard.

This use case draws on both the guide and the extension to develop a workflow for incorporating a DNA derived data extension file into a Darwin Core archive.

The latest version of edna2obis (version 3) builds upon the original edna2obis, introducing new features:

  • Moved from a Jupyter Notebook to script architecture (runs in one command)
  • Specify parameters in configuration files, rather than in the code
  • Supports both generic FAIRe eDNA data format and FAIRe NOAA format (compatible for upload to the Ocean DNA Explorer)
  • Improved taxonomic assignment accuracy and performance, with new caching methods
    • Users can choose to perform their taxonomic assignment via WoRMS or GBIF APIs
    • Users can specify which assays to NOT include species rank for taxonomic assignment (for example, Bacterial taxonomies often have the HOST organism as the species)
    • New output taxa_assignment_INFO_<API>.csv documents how taxonomies were assigned (sheet taxa_assignment_INFO). Start with the selected_match column—it marks the one row per name that the pipeline used (or would use) for the occurrence file; other rows are alternate candidates.
  • Generates an HTML output report, edna2obis_report.html to document your run
  • Options to generate an extended Measurement of Fact file and a Project-level EML metadata file
  • You can use the taxonomic assignment algorithms for WoRMS and GBIF taxonomy backbones on a simple input file of taxonomies, and just get taxonomic assignments without running through the entire edna2obis workflow via taxassign.py. It can be run as a script using python taxassign.py or can run it via the command line. You can set parameters in the command line or in the Python file itself. Output is the same style of taxa_assignment_INFO_<API>.csv as the full pipeline—filter to selected_match True to see the match that would be carried forward, same as in the main workflow.

Example data abstract:

Seawater was collected on board the NOAA ship Ronald H. Brown as part of the fourth Gulf of Mexico Ecosystems and Carbon Cycle (GOMECC-4) cruise from September 13 to October 21, 2021. Sampling for GOMECC-4 occurred along 16 coastal-offshore transects across the entire Gulf of Mexico and an additional line at 27N latitude in the Atlantic Ocean. We also collected eDNA samples near Padre Island National Seashore (U.S. National Parks Service), a barrier island located off the coast of south Texas. Vertical CTD sampling was employed at each site to measure discrete chemical, physical, and biological properties. Water sampling for DNA filtration was conducted at 54 sites and three depths per site (surface, deep chlorophyll maximum, and near bottom) to capture horizontal and vertical gradients of bacterial, protistan, and metazoan diversity across the Gulf. The resulting ASVs, their assigned taxonomy, and the metadata associated with theircollection are the input data for the OBIS conversion scripts presented here.

Published data

Input Data Format

Quick overview

  • Metadata tables come from running FAIReSheets (projectMetadata, sampleMetadata, experimentRunMetadata; and the NOAA data format variation requires an analysisMetadata sheet per analysis run).
  • Raw ASV taxonomy and abundance tables come from Tourmaline (or any amplicon sequence processing workflow) as long as they follow Tourmaline's output structure.

Inputs and outputs

Supported Data Formats

edna2obis supports two FAIRe eDNA data formats (both formats can be generated by FAIReSheets):

  • FAIRe generic: Standard FAIRe layout. Analysis settings live in projectMetadata. Sequence ID column is typically seq_id in raw tables.
  • FAIRe NOAA: Adds analysisMetadata per analysis run; optimized for Ocean DNA Explorer compatibility.

Both share the same core table ideas; examples below show the NOAA flavor. Differences for the generic flavor are noted along the way.

Metadata: NOAA Omics FAIR eDNA-based metadata template

The FAIRe NOAA Google Sheet metadata template developed by NOAA Omics at AOML, and based off the FAIRe eDNA data standard. To use the sheet for your own data, run FAIReSheets, and it will generate the FAIRe NOAA templates in Google Sheets. Here is a filled-in example:

FAIRe_NOAA_noaa-aoml-gomecc4_SHARING

projectMetadata

Project wide (project_level) project metadata, and metadata unique to each assay

Note: In generic FAIRe format, analysis metadata is included in this sheet rather than in separate analysisMetadata files.

term_name project_level ssu16sv4v5-emp (1st assay) ssu18sv9-emp (2nd assay)
recordedBy Luke Thompson
recordedByID https://orcid.org/0000-0002-3911-1280
project_contact Luke Thompson
institution NOAA/AOML
institutionID https://www.aoml.noaa.gov/omics
project_name eDNA from Gulf of Mexico Ecosystems and Carbon Cruise 2021 (GOMECC-4)
project_id noaa-aoml-gomecc4
parent_project_id noaa-aoml-gomecc
study_factor water column spatial series
assay_type metabarcoding
sterilise_method After sampling, run ~1 L of 5% bleach through tubing lines, then rep...
checkls_ver FAIRe_checklist_v1.0.xlsx
mod_date 2024-10-31
license http://creativecommons.org/publicdomain/zero/1.0/legalcode
rightsHolder US Government
accessRights no rights reserved
assay_name ssu16sv4v5-emp ssu18sv9-emp
ampliconSize 411 260
code_repo https://github.com/aomlomics/gomecc
biological_rep 3

sampleMetadata

Contextual data about the samples collected. Each row is a distinct sample (Event)

Note: This structure is largely the same between generic FAIRe and FAIRe NOAA formats.

samp_name materialSampleID geo_loc_name eventDate decimalLatitude decimalLongitude sampleSizeValue sampleSizeUnit env_broad_scale env_local_scale env_medium samp_collect_device samp_vol_we_dna_ext samp_mat_process size_frac
GOMECC4_27N_Sta1_Deep_A GOMECC4_27N_Sta1_Deep USA: Atlantic Ocean, east of Florida (27 N) 2021-09-14T11:00-04:00 26.997 -79.618 1920 mL marine biome [ENVO:00000447] marine mesopelagic zone [ENVO:00000213] sea water [ENVO:00002149] Niskin bottle on CTD rosette 1920 mL Pumped through Sterivex filter (0.22-µm) using peristaltic pump 0.22 µm
GOMECC4_27N_Sta1_Deep_B GOMECC4_PANAMACITY_Sta1_Deep USA: Atlantic Ocean, east of Florida (27 N) 2021-09-20T23:13-04:00 26.997 -79.618 1920 mL marine biome [ENVO:00000447] marine mesopelagic zone [ENVO:00000213] sea water [ENVO:00002149] Niskin bottle on CTD rosette 1920 mL Pumped through Sterivex filter (0.22-µm) using peristaltic pump 0.22 µm

experimentRunMetadata

Library preparation and sequencing details

Note: This structure is largely the same between generic FAIRe and FAIRe NOAA formats.

samp_name assay_name pcr_plate_id lib_id seq_run_id mid_forward mid_reverse filename filename2 input_read_count
GOMECC4_NegativeControl_1 ssu16sv4v5-emp not applicable GOMECC16S_Neg1 20220613_Amplicon_PE250 TAGCAGCT CTGTGCCTA GOMECC16S_Neg1_S499_L001_R1_001.fastq.gz GOMECC16S_Neg1_S499_L001_R2_001.fastq.gz 29319
GOMECC4_NegativeControl_2 ssu16sv4v5-emp not applicable GOMECC16S_Neg2 20220613_Amplicon_PE250 TAGCAGCT CTAGGACTA GOMECC16S_Neg2_S500_L001_R1_001.fastq.gz GOMECC16S_Neg2_S500_L001_R2_001.fastq.gz 30829

analysisMetadata

Bioinformatic analysis configuration metadata. There is one analysisMetadata sheet PER analysis. Append the analysis_run_name to the filename, ex: analysisMetadata_gomecc4_16s_p1-2_v2024.10_241122.tsv

Note: analysisMetadata sheet(s) is only present in FAIRe NOAA format. In generic FAIRe format, this information is included in the projectMetadata sheet.

Field Value
project_id noaa-aoml-gomecc4
assay_name ssu16sv4v5-emp
analysis_run_name gomecc4_16s_p1-2_v2024.10_241122
sop_bioinformatics https://github.com/aomlomics/gomecc
trim_method cutadapt
trim_param qiime cutadapt trim-paired
demux_tool qiime2-2021.2; bcl2fastq v2.20.0
merge_tool qiime2-2021.2; DADA2 1.18
min_len_cutoff 200
otu_db Silva SSU Ref NR 99 v138.1; 515f-926r region; 10.5281/zenodo.8392695
otu_seq_comp_appr Tourmaline; qiime2-2021.2

Raw Data: ASV Taxonomies and Abundance Tables

You must have 2 raw data files associated with each analysis (analysisMetadata) in your submission. These files are generated by Tourmaline v2, AOML Omic's amplicon sequence processing workflow.

Note: Raw data structure is largely the same between formats, with one key difference: in generic FAIRe format, the sequence identifier column is named seq_id instead of featureid.

If your data was generated with Qiime2 or a previous version of Tourmaline, you can convert the table.qza, taxonomy.qza, and repseqs.qza outputs to the correct format using the create_asv_seq_taxa_obis.sh shell script.

Example:

#Run this with a qiime2 environment. 
bash create_asv_seq_taxa_obis.sh -f \
../gomecc_v2_raw/table-16S-merge.qza -t ../gomecc_v2_raw/taxonomy-16S-merge.qza -r ../gomecc_v2_raw/repseqs-16S-merge.qza \
-o ../gomecc_v2_raw/gomecc-16S-asv.tsv

Your ASV raw data files should look like this:

ASV Taxonomy Features:

featureid dna_sequence taxonomy verbatimIdentification kingdom phylum other_ranks... species Confidence
1ce3b5c6d... TACGA... Bacteria;Proteobacteria;Alphaproteoba... d__Bacteria;p__Proteoba... Bacteria Proteobacteria ... Clade_Ia 0.88
4e38e8ced... GCTACTAC... Eukaryota;Obazoa;Opisthokonta;Metazoa... Eukaryota;Obazoa;Opisthokonta;Metazoa... Eukaryota Obazoa ... Clausocalanus furcatus 0.999

Note: In generic FAIRe format, the first column would be named seq_id instead of featureid.

NOTE: We understand taxonomy is complicated, so edna2obis is flexible and can receive any list of taxonomic ranks (as long as they are between columns verbatimIdentification and Confidence). For example, our 16S and 18S assay data use different taxonomic ranks, and even have a different number of taxonomic ranks. The code can account for this, and assigns taxonomies based on what ranks each API returns.

The verbatimIdentification strings may or may not have the prepending rank with underscores. The code will remove them during processing if they exist.

featureid is a hash of the DNA sequence, and they are unique identifiers.

Note: In generic FAIRe format, this column is named seq_id instead of featureid.

Some field's values have been truncated (...) for readability in the documentation. Please include the complete data for each field in your input files.

ASV Taxonomy: what edna2obis uses

  • This raw taxonomy table is generated by FAIReSheets in both generic FAIRe and NOAA-FAIRe formats
  • You can fill in the raw taxonomy table Google Sheet, or if you run Tourmaline, you can just use the raw taxonomy table from that output (they are the same format).
  • edna2obis sends the value in verbatimIdentification to the selected taxonomy API (after cleaning common prefixes and formatting).
  • The API response is then used to fill most of the taxonomy fields in your final outputs (e.g., standard ranks and identifiers).

ASV Abundance Tables:

featureid GOMECC4_BROWNSVILLE_Sta63_DCM_A GOMECC4_BROWNSVILLE_Sta63_DCM_B GOMECC4_CAMPECHE_Sta91_DCM_A
1ce3b5c6d... 0 32 2
4e38e8ced... 15 0 45

Each column name after featureid is a sample name, and must correspond with your sampleMetadata.

Note: In generic FAIRe format, the first column would be named seq_id instead of featureid.

If your abundance tables have decimal numbers, that is okay too.

Configuration and Workflow

How edna2obis works

Configure your run using the files below; the graphic shows how these inputs flow through edna2obis to the outputs.

edna2obis uses several configuration files to customize the conversion process. All configuration files are located in the root directory.

Main Configuration Files

config.yaml

The primary configuration file that controls the overall pipeline behavior:

  • Data file paths: Specify paths to your Excel metadata file and raw data files
  • Taxonomic assignment: Choose between "WoRMS" or "GBIF" APIs for taxonomic assignment
  • Output settings: Configure output directory and file naming
  • Custom field handling: Configure how to process specific metadata fields
  • Processing parameters: Set parallel processing limits and caching options

data_mapper.yaml

Maps FAIRe metadata fields to Darwin Core terms:

  • Field mappings: Maps FAIRe fields to Darwin Core standards
  • Format-specific mappings: Different mappings for generic vs NOAA FAIRe formats

EML_config.yaml

Controls Ecological Metadata Language (EML) generation:

  • Dataset metadata: Project descriptions, contact information, licensing
  • Geographic coverage: Study area descriptions and bounding boxes
  • Temporal coverage: Study period and sampling frequency
  • Method descriptions: Detailed protocols and methodologies

eMoF Configuration

The Extended Measurement or Fact (eMoF) file can be customized to include additional measurements:

  • Template file: raw-v3/eMoF_Fields_edna2obis.xlsx
  • Custom measurements: Add your own measurement types and values
  • Controlled vocabularies: Use OBIS-approved terms for measurement types and units
  • Documentation: See OBIS eMoF formatting guide for detailed instructions

You can add custom fields to the eMoF template to include additional environmental measurements, sampling parameters, or any other data linked to your events. If there are fields in the eMoF template that are not in your data, don't worry, the code will account for that!

Example Configuration Files

config_FAIRe_noaa.yaml

Example configuration for FAIRe NOAA format data:

  • Pre-configured for Ocean DNA Explorer compatibility
  • Optimized settings for NOAA-specific metadata structure
  • Includes NOAA-specific field mappings

config_FAIRe_generic.yaml

Example configuration for generic FAIRe format data:

  • Standard FAIRe eDNA data format settings
  • Generic field mappings and processing parameters
  • Compatible with standard FAIRe workflows

🚀 Setup and Installation

Prerequisites

  • Conda or Anaconda installed
  • Git installed
  • At least 8GB RAM recommended
  • Internet connection required (for API calls to WoRMS/GBIF)

Quick Start

1. Clone the Repository

git clone https://github.com/aomlomics/edna2obis.git
cd edna2obis

2. Create Conda Environment

# Create the environment from the environment.yml file
conda env create -f environment.yml

# Activate the environment
conda activate edna2obis

3. Edit the Configuration Files

Edit the configuration files with your data filepaths and other parameters:

Primary configuration:

  • Edit config.yaml for main pipeline settings
  • You can copy config_FAIRe_noaa.yaml or config_FAIRe_generic.yaml into config.yaml as a starting point based on your data format

Additional configuration (optional):

  • Modify data_mapper.yaml for custom field mappings
  • Update EML_config.yaml for metadata generation settings, or specify you don't want an EML file in config.yaml
  • Customize raw-v3/eMoF_Fields_edna2obis.xlsx for additional measurements, or specify you don't want an eMoF file in config.yaml

Key settings to update in config.yaml:

  • excel_file: Path to your FAIRe Excel file (data template)
  • datafiles: Paths to your ASV taxonomy and occurrence files
  • taxonomic_api_source: Choose "WoRMS" or "GBIF"
  • output_dir: Where to save results (default: "processed-v3/")

4. Run the Pipeline

python main.py

The pipeline will:

  • Load and clean your metadata (according to OBIS/GBIF)
  • Align data to Darwin Core data standard
  • Generate an Occurrence Core
  • Perform taxonomic assignment via WoRMS or GBIF APIs
  • Generate a DNA Derived Extension
  • Create an HTML report with results from your run

Run taxonomic assignment only (taxassign.py)

If you only want to assign taxonomy to a list of identifiers (without running the full edna2obis workflow), use taxassign.py.

  • Input: a TSV/CSV with a single column named verbatimIdentification. An example is provided at raw-v3/taxassign_example_input.tsv.
  • Output: taxa_assignment_INFO_<API>.csv (same column layout as the full pipeline; sheet taxa_assignment_INFO only). Important! selected_match: it is True on the row that would be chosen as the official assignment (equivalent to what goes to occurrence in the full pipeline). You may get several candidate rows per name; the rest are for review. Up to N candidate rows per name unless you omit -n and use --use-config to take gbif_match_limit from config.yaml.

Help:

python taxassign.py --help

Examples:

# Example input, default API and limits from taxassign.py, writes processed-v3/taxa_assignment_INFO_<API>.csv
python taxassign.py

# Use WoRMS and a custom input
python taxassign.py -i raw-v3/taxassign_example_input.tsv -a WoRMS

# Up to 5 candidate rows per name
python taxassign.py -i raw-v3/taxassign_example_input.tsv -a GBIF -n 5

# Explicit output path
python taxassign.py -i raw-v3/taxassign_example_input.tsv -a GBIF -o processed-v3/my_run.csv

# Matcher options from config.yaml
python taxassign.py --use-config

# Parallelism
python taxassign.py -i raw-v3/taxassign_example_input.tsv -a GBIF --n-proc 3

Options:

  • -i, --input: TSV/CSV with column verbatimIdentification (default: raw-v3/taxassign_example_input.tsv)
  • -a, --api: GBIF or WoRMS (omit with --use-config to use taxonomic_api_source from config)
  • -n, --limit: max candidate rows per name (omit with --use-config to use gbif_match_limit from config)
  • -o, --output: output .csv path (not a folder). If omitted, {outdir}/taxa_assignment_INFO_<API>.csv
  • --outdir: directory when -o omitted (default: processed-v3)
  • --use-config: load matcher settings from config.yaml beside taxassign.py
  • --n-proc: parallel workers (optional)

In-file defaults (no CLI needed):

  • You can also set defaults directly at the top of taxassign.py in the DEFAULTS block (input path, API, match limit, outdir/output, n-proc). Any CLI flags you pass will override those defaults.

Output Files

The pipeline generates several files in your output directory:

  • processed-v3/
    • edna2obis_report_worms.html / edna2obis_report_gbif.html - Detailed HTML report of the conversion process.
    • occurrence_core_worms.csv / occurrence_core_gbif.csv - Final Occurrence Core with assigned taxonomies.
    • taxa_assignment_INFO_worms.csv / taxa_assignment_INFO_GBIF.csv - All candidate matches per name; use selected_match to see which row was used for the occurrence file (see column table below).
    • dna_derived_extension.csv - DNA Derived Data extension file.
    • eMoF.csv - eMoF (extended Measurement or Fact) extension file.

Occurrence Core (GBIF example)

occurrenceID eventID verbatimIdentification kingdom phylum class order family genus scientificName taxonRank organismQuantity organismQuantityType recordedBy materialSampleID eventDate locality decimalLatitude decimalLongitude basisOfRecord nameAccordingTo
GU190706-CTD11-220_MiFish_S30_occ_18109634cc2f8e156e5402bf13cf4502 GU190706-CTD11-220_MiFish_S30 Eukaryota;Chordata;Actinopteri;Beloniformes;Exocoetidae;Cheilopogon Animalia Chordata Beloniformes Exocoetidae Cheilopogon Cheilopogon Lowe, 1841 genus 4 DNA sequence reads Lynsey Wilcox Talbot | Katherine Silliman GU190706-CTD11-220 2019-07-06 00:00:00 USA: Gulf of Mexico -85.793 28.662 MaterialSample GBIF
GU190706-CTD11-220_MiFish_S30_occ_183bc18f3e5eac45c6dd248fb86d64bf GU190706-CTD11-220_MiFish_S30 Eukaryota;Chordata;Actinopteri;Tetraodontiformes;Tetraodontidae;Lagocephalus;Lagocephalus laevigatus Animalia Chordata Tetraodontiformes Tetraodontidae Lagocephalus Lagocephalus laevigatus (Linnaeus, 1766) species 5317 DNA sequence reads Lynsey Wilcox Talbot | Katherine Silliman GU190706-CTD11-220 2019-07-06 00:00:00 USA: Gulf of Mexico -85.793 28.662 MaterialSample GBIF

DNA Derived Extension

eventID source_mat_id samp_name env_broad_scale env_local_scale env_medium samp_vol_we_dna_ext samp_collect_device samp_mat_process size_frac concentration lib_layout seq_meth nucl_acid_ext target_gene target_subfragment pcr_primer_forward pcr_primer_reverse pcr_primer_name_forward pcr_primer_name_reverse pcr_primer_reference pcr_cond nucl_acid_amp ampliconSize otu_seq_comp_appr otu_db occurrenceID DNA_sequence concentrationUnit otu_class_appr
GU190706-CTD11-220_MiFish_S30 GU190706-CTD11-220 GU190706-CTD11-220 marine biome [ENVO:00000447] marine mesopelagic zone [ENVO:00000213] sea water [ENVO:00002149] 2 Niskin bottle Samples were vacuum-filtered through a MilliporeSigma 47 mm diameter mixed cellulose ester (MCE) filter with... 0.45 1.57 paired end Illumina MiSeq [OBI_0002003] https://doi.org/10.1002/edn3.70074 12S rRNA (SSU mitochondria) V5-V6 GTCGGTAAAACTCGTGCCAGC CATAGTGGGGTATCTAATCCCAGTTTGT MiFish-U-F MiFish-U-R2 https://doi.org/10.1098/rsos.150088 initial denaturation:98_30s; 40 cycles of denaturation: 98_20s, annealing:60_20s, elongation:72_20s; final elongation:72_5min not applicable 175 qiime2-2023.5; naive-bayes classifier; scikit-learn 0.24.1 custom GU190706-CTD11-220_MiFish_S30_occ_18109634cc2f8e156e5402bf13cf4502 CACCGCGGTTATACGAGAGGCCTAAGTTGACAGACAACGGCGTAAAGAGTGGTTAAGGAAAAATTTATACTAAAGCCGAACATCCTCAAGACTGTCGTACGTTTCCGAGGATATGAAGTCCCCCTACGAAAGTGGCTTTAACTCCCCTGACCCCACGAAAGCTGTGAC ng/µl qiime2-2023.5; DADA2 1.26.0
GU190706-CTD11-220_MiFish_S30 GU190706-CTD11-220 GU190706-CTD11-220 marine biome [ENVO:00000447] marine mesopelagic zone [ENVO:00000213] sea water [ENVO:00002149] 2 Niskin bottle Samples were vacuum-filtered through a MilliporeSigma 47 mm diameter mixed cellulose ester (MCE) filter with... 0.45 1.57 paired end Illumina MiSeq [OBI_0002003] https://doi.org/10.1002/edn3.70074 12S rRNA (SSU mitochondria) V5-V6 GTCGGTAAAACTCGTGCCAGC CATAGTGGGGTATCTAATCCCAGTTTGT MiFish-U-F MiFish-U-R2 https://doi.org/10.1098/rsos.150088 initial denaturation:98_30s; 40 cycles of denaturation: 98_20s, annealing:60_20s, elongation:72_20s; final elongation:72_5min not applicable 175 qiime2-2023.5; naive-bayes classifier; scikit-learn 0.24.1 custom GU190706-CTD11-220_MiFish_S30_occ_183bc18f3e5eac45c6dd248fb86d64bf CACCGCGGTTATACGATGAAGCCCAAGTTGTTAGCCTTCGGCGTAAAGAGTGGTTAGAGTACCCCAACAAAACTAAGGCCGAACACCTTCAGGGCAGTCATACGCTTTCGAAGGCATGAAGCACACCAACGAAAGTAGCCTTACCAGACTTGAACCCACGAAAGCTAAGAT ng/µl qiime2-2023.5; DADA2 1.26.0

Taxonomic Assignment Algorithms

WoRMS

  • Clean verbatimIdentification: split by ;, replace _ - / with spaces, trim, remove trailing “sp.”/“spp.” and numbers, drop empty/“unassigned”.
  • If it exists as a species by AphiaID in the local reference database file provided (optionally), look up AphiaID directly and fill fields.
  • Otherwise, use WoRMS “Match Names”:
    • Start from the most specific level (ex: species) and move broader only if needed.
    • Keep only records with status “accepted” and add every accepted alternative to the review list.
    • Use the most specific level that returns an accepted record for the assignment (ex: favors a genus assignment over a class assignment).
  • If an assay is set to skip species, drop the last level before searching.
  • If nothing accepted, set scientificName=incertae sedis and clear ranks.
  • Fill: scientificName, scientificNameID (LSID), taxonRank, ranks (kingdom … species), nameAccordingTo=WoRMS, plus cleanedTaxonomy and match_type_debug.
  • Endpoints: AphiaID record; Match Names.

GBIF

  • Clean verbatimIdentification as above and remove rank prefixes like d__, p__, etc.
  • Try the most specific level first; move broader only if needed.
  • For each candidate from the initial lookup, confirm against the GBIF backbone to get a confidence score.
  • Choose the highest-confidence accepted match; include other accepted candidates in the review list. If none, set scientificName=incertae sedis.
  • If an assay is set to skip species, drop the last level before searching.
  • Cache results to speed up future runs.
  • Fill: scientificName, taxonID (e.g., gbif:<usageKey>), taxonRank, ranks (kingdom … genus), confidence, nameAccordingTo=GBIF, plus cleanedTaxonomy and match_type_debug.
  • Endpoints: name_lookup; name_backbone.

Settings that affect matching

  • taxonomic_api_source: "WoRMS" or "GBIF"
  • assays_to_skip_species_match: assays where species level is ignored
  • Per-assay maximum depth: inferred from your inputs; used for species skipping
  • GBIF candidate limit and caching
  • Local reference database (WoRMS only) for fast AphiaID lookups

Also writes taxa_assignment_INFO_<API>.csv (sheet taxa_assignment_INFO). One row can appear per candidate match, not only the match used in the occurrence file.

taxa_assignment_INFO columns

Important column! selected_match is True on the row the pipeline treats as the official assignment for each verbatimIdentification (the one reflected in the occurrence file). For taxassign.py-only runs, it is True on the row that would be chosen in the full pipeline. When you summarize results, filter on selected_match = TRUE; other assignment rows exist for transparency and QA.

Columns are ordered with selected_match immediately after cleanedTaxonomy in the .csv file.

Column Meaning
verbatimIdentification Original taxonomic string from your data before matching.
cleanedTaxonomy Normalized / cleaned version of verbatimIdentification (what is actually used for API lookup.
selected_match Indicates the taxonomic assignment! True only on the chosen assignment row for that verbatimIdentification (occurrence file in full pipeline; same rule for taxassign-only output). False on alternate candidate rows kept for review.
ambiguous WoRMS. True when more than one candidate assignment was found for this verbatim string.
replaced_unaccepted WoRMS. True when WoRMS replaced an unaccepted name with the accepted valid name.
unaccepted_match WoRMS. True when the assignment in that row is an unaccepted name. Shows you the unaccepted name for comparison.
ranks_matched WoRMS. Number of taxonomic ranks given in your verbatimIdentification that perfectly matched with the WoRMS assignment's ranks.
ranks_provided WoRMS. Number of taxonomic ranks given in your verbatimIdentification for that taxonomy.
assignment_score WoRMS. Ratio of ranks_matched / ranks_provided.
environment WoRMS habitat labels when available. Non-marine taxa can be included in results when worms_return_all_matches is true in config.yaml.
scientificName Scientific name for this candidate row from the backbone.
confidence GBIF only. Assignment confidence score from 0 to 100.
taxonRank Rank of scientificName assigned.
scientificNameID WoRMS only. LSID for the taxon.
taxonID GBIF only. Backbone taxonomic identifier.
higherClassification WoRMS only. Pipe-separated lineage when worms_return_higher_classification is enabled in config.yaml. Slows performance.
kingdom Darwin Core kingdom.
phylum Darwin Core phylum.
class Darwin Core class.
order Darwin Core order.
family Darwin Core family.
genus Darwin Core genus.
match_type_debug Short code for how this row was matched via the API.
nameAccordingTo Which API you used to assign taxonomy.

eMoF (extendedMeasurementOrFact)

The eMoF file captures occurrence-level measurements linked to each occurrenceID that made it into the final occurrence file. This creates a larger file but is what GBIF requires for data submission.

  • What it contains: One row per occurrence per configured measurement.
  • Where it comes from: Measurement values are sourced from sampleMetadata first, otherwise experimentRunMetadata.
  • Units:
    • If the eMoF template specifies a literal unit (e.g., m, °C), that unit is used for every emitted row of that measurementType.
    • If the template says provided, a column named <measurementType>_unit must be present in the chosen source sheet and must be non-blank for all emitted rows.
    • If the template leaves the unit blank, output unit is blank (no auto-fallback).
  • Template: Configure measurements in raw-v3/eMoF_Fields_edna2obis.xlsx on the input_file sheet. Required columns: measurementType, measurementValue, measurementUnit, measurementTypeID, measurementValueID, measurementUnitID, measurementRemarks.
  • Output: Written to processed-v3/eMoF.csv.

Customizing eMoF Measurements

You can add custom measurements to your eMoF file by editing the template file raw-v3/eMoF_Fields_edna2obis.xlsx. This allows you to include:

  • Environmental measurements: Temperature, salinity, pH, dissolved oxygen, etc.
  • Sampling parameters: Gear type, sampling depth, volume filtered, etc.
  • Laboratory measurements: DNA concentration, extraction efficiency, etc.
  • Any other data: Linked to your events or occurrences

For detailed guidance on formatting eMoF files and using controlled vocabularies, see the OBIS eMoF formatting guide.

eMoF Preview (example)

Below is a small, illustrative preview of the eMoF structure. Your actual content will depend on your eMoF template and metadata.

eventID occurrenceID verbatimMeasurementType measurementType measurementValue measurementUnit measurementTypeID measurementValueID measurementUnitID measurementRemarks
GU190706-CTD11-220_MiFish_S30 GU190706-CTD11-220_MiFish_S30_occ_ASV_001 temperature Temperature 25.5 °C http://vocab.nerc.ac.uk/collection/P01/current/TEMPPR01/ http://vocab.nerc.ac.uk/collection/P06/current/UPAA/
GU190706-CTD11-220_MiFish_S30 GU190706-CTD11-220_MiFish_S30_occ_ASV_002 temperature Temperature 25.5 °C http://vocab.nerc.ac.uk/collection/P01/current/TEMPPR01/ http://vocab.nerc.ac.uk/collection/P06/current/UPAA/

Troubleshooting

Common Issues

  1. Environment creation fails

    # Try updating conda first
    conda update conda
    conda env create -f environment.yml
  2. API timeout errors

    • Reduce worms_n_proc or gbif_n_proc in config.yaml
  3. Missing data files

    • Verify all file paths in config.yaml are correct
    • Use absolute paths if relative paths don't work

Getting Help

  • Check the HTML report for detailed error messages
  • Review the terminal output for specific error details
  • Ensure your input data follows the FAIRe NOAA format

Recommended System Requirements

  • Processing: 8GB+ RAM, 4+ CPU cores
  • Storage: ~1GB free space for large datasets
  • Network: Stable internet for API calls

Disclaimer

This repository is a scientific product and is not official communication of the National Oceanic and Atmospheric Administration, or the United States Department of Commerce. All NOAA GitHub project code is provided on an 'as is' basis and the user assumes responsibility for its use. Any claims against the Department of Commerce or Department of Commerce bureaus stemming from the use of this GitHub project will be governed by all applicable Federal law. Any reference to specific commercial products, processes, or services by service mark, trademark, manufacturer, or otherwise, does not constitute or imply their endorsement, recommendation or favoring by the Department of Commerce. The Department of Commerce seal and logo, or the seal and logo of a DOC bureau, shall not be used in any manner to imply endorsement of any commercial product or activity by DOC or the United States Government.

About

Code to convert eDNA metabarcoding data to Darwin Core for OBIS

Resources

License

Stars

Watchers

Forks

Packages

 
 
 

Contributors